# Getting Started **Primer3-py** is designed to be simple to install and use. ```{contents} ``` ## Requirements **Primer3-py** is built and tested on Mac OS X and Linux systems; we do not provide official Windows support. Python versions 3.8 - 3.11 are supported. ## Installation If you want to install the latest stable build of **Primer3-py**, you can install it using `pip`: ```bash $ pip install primer3-py ``` Or via `conda`: ```bash $ conda install primer3-py ``` ## Thermodynamic analysis The thermodynamic {py:mod}`bindings` include support for **Tm, homodimer, heterodimer, hairpin,** and **3' end stability calculations**: ```{eval-rst} .. py:function:: calc_tm(seq, mv_conc=50, dv_conc=0, dntp_conc=0.8, \ dna_conc=50, dmso_conc=0.0, dmso_fact=0.6, \ formamide_conc=0.8, annealing_temp_c=-10.0, \ max_nn_length=60, tm_method='santalucia', \ salt_corrections_method='santalucia') Calculates the melting temperature of a DNA sequence, ``seq``. Returns the melting temperature (C) as a float:: >>> primer3.calc_tm('GTAAAACGACGGCCAGT') 49.16808228911765 Note that NN thermodynamics will be used to calculate the Tm of sequences up to 60 bp in length, after which point the following formula will be used:: Tm = 81.5 + 16.6(log10([mv_conc])) + 0.41(%GC) - 600/length ``` ```{eval-rst} .. py:function:: calc_hairpin(seq, mv_conc=50.0, dv_conc=0.0, dntp_conc=0.8, \ dna_conc=50.0, temp_c=37, max_loop=30, \ output_structure=False) Calculates the hairpin formation thermodynamics of a DNA sequence, ``seq``. Returns a :class:`ThermoResult` object that provides access to the thermodynamic characteristics of the result:: >>> res = primer3.calc_hairpin('CCCCCATCCGATCAGGGGG') >>> print(res) ThermoResult(structure_found=True, tm=34.15, dg=337.09, dh=-36300.00, ds=-118.13, msg=) >>> print(res.tm) 34.14640571476207 >>> print('%f, %f, %f' % (res.dg, res.dh, res.ds)) 337.086509, -36300.000000, -118.126992 **Note that at least one of the two sequences must by <60 bp in length.** This is a cap imposed by Primer3 as the longest reasonable sequence length for which a two-state NN model produces reliable results (see ``primer3/src/libnano/thal.h:59``). ``` ```{eval-rst} .. py:function:: calc_homodimer(seq, mv_conc=50.0, dv_conc=0.0, dntp_conc=0.8, \ dna_conc=50.0, temp_c=37, max_loop=30, \ output_structure=False) Calculates the homodimer formation thermodynamics of a DNA sequence, ``seq``. Returns a :class:`ThermoResult` object that provides access to the thermodynamic characteristics of the result (see :py:func:`calc_hairpin` doc for more information). **Note that the maximum length of ``seq`` is 60 bp.** This is a cap imposed by Primer3 as the longest reasonable sequence length for which a two-state NN model produces reliable results (see ``primer3/src/libprimer3/thal.h:59``). ``` ```{eval-rst} .. py:function:: calc_heterodimer(seq1, seq2, mv_conc=50.0, dv_conc=0.0, \ dntp_conc=0.8, dna_conc=50.0, temp_c=37, \ max_loop=30, output_structure=False) Calculates the heterodimerization thermodynamics of two DNA sequences, ``seq1`` and ``seq2``. Returns a :class:`ThermoResult` object that provides access to the thermodynamic characteristics of the result (see :py:func:`calc_hairpin` doc for more information). **Note that at least one of the two sequences must by <60 bp in length.** This is a cap imposed by Primer3 as the longest reasonable sequence length for which a two-state NN model produces reliable results (see ``primer3/src/libprimer3/thal.h:59``). ``` ```{eval-rst} .. py:function:: calc_end_stability(seq1, seq2, mv_conc=50.0, dv_conc=0.0, \ dntp_conc=0.8, dna_conc=50.0, temp_c=37, \ max_loop=30) Calculates the 3' end stability of DNA sequence ``seq1`` against DNA sequence ``seq2``. Returns a :class:`ThermoResult` object that provides access to the thermodynamic characteristics of the result (see :py:func:`calc_hairpin` doc for more information). **Note that at least one of the two sequences must by <60 bp in length.** This is a cap imposed by Primer3 as the longest reasonable sequence length for which a two-state NN model produces reliable results (see ``primer3/src/libprimer3/thal.h:59``). ``` All of these low-level thermodynamic functions share a set of keyword arguments used to define the parameters of the respective calculation: ```{eval-rst} `For all low-level calculations`: **mv_conc** (float/int) Monovalent cation concentration (mM) **dv_conc** (float/int) Divalent cation concentration (mM) **dntp_conc** (float/int) dNTP concentration (mM) **dna_conc** (float/int) DNA concentration (nM) `For homodimer/heterodimer/end stabilty calculation`: **temp_c** (int) Simulation temperature for dG calcs (C) **max_loop** (int) Maximum size of loops in the structure `For Tm calculations`: **dmso_conc** (float) Concentration of DMSO (%) **dmso_fact** (float) DMSO correction factor **formamide_conc** (float) Concentration of formamide (mol/l) **annealing_temp_c** (float) Actual annealing temperature of the PCR reaction **max_nn_length** (int) Maximum length for nearest-neighbor calcs **tm_method** (str) Tm calculation method (breslauer or santalucia) **salt_corrections_method** Salt correction method (schildkraut, wczarzy, santalucia) ``` ## Primer design **Primer3-py** includes bindings for the Primer3 primer design pipeline. The parameters for the design process are provided as Python dictionaries that mirror the BoulderIO input files required by the Primer3 binaries. There are numerous examples of how to use the pipeline in the `tests/` directory. For documentation regarding the input and output parameters of the pipeline, please see the [Primer3 2.6.1 documentation](https://htmlpreview.github.io/?https://github.com/primer3-org/primer3/blob/v2.6.1/src/primer3_manual.htm) (the underlying library for this package is a derivative of v2.6.1). It is worth noting that some of the inputs deviate from the string format described in the Primer3 documentation, with notable exceptions being related to index lists and ranges (i.e., ranges are typically provided as lists/tuples, and lists of ranges as lists of lists or tuples of tuples). Here we highlight the differences between the typical `SEQUENCE_PRIMER_PAIR_OK_REGION_LIST` input and the Python binding input: ``` Primer3 BoulderIO input: 100,50,300,50 ; 900,60,, Primer3-py Python input: [[100,50,300,50], [900,60,-1,-1]] ``` Similarly, `PRIMER_PRODUCT_SIZE_RANGE` is provided in the following forms: ``` Primer3 BoulderIO input: 75-100 100-125 125-150 Primer3-py Python input: [[75,100],[100,125],[125,150]] ``` ### Workflow The easiest way to run the primer design pipeline is with {py:func}`design_primers`. Notice that Primer3 parameters prefixed with "SEQUENCE\_" are provided in a separate dictionary from those prefixed with "PRIMER\_". For more advanced / modular approaches, see the {doc}`api/bindings` documentation. ```{eval-rst} .. autofunction:: primer3.bindings.design_primers ``` Example usage: ``` bindings.design_primers( seq_args={ 'SEQUENCE_ID': 'MH1000', 'SEQUENCE_TEMPLATE': 'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTACATTTT' 'AGCATCAGTGAGTACAGCATGCTTACTGGAAGAGAGGGTCATGCA' 'ACAGATTAGGAGGTAAGTTTGCAAAGGCAGGCTAAGGAGGAGACG' 'CACTGAATGCCATGGTAAGAACTCTGGACATAAAAATATTGGAAG' 'TTGTTGAGCAAGTNAAAAAAATGTTTGGAAGTGTTACTTTAGCAA' 'TGGCAAGAATGATAGTATGGAATAGATTGGCAGAATGAAGGCAAA' 'ATGATTAGACATATTGCATTAAGGTAAAAAATGATAACTGAAGAA' 'TTATGTGCCACACTTATTAATAAGAAAGAATATGTGAACCTTGCA' 'GATGTTTCCCTCTAGTAG', 'SEQUENCE_INCLUDED_REGION': [36,342] }, global_args={ 'PRIMER_OPT_SIZE': 20, 'PRIMER_PICK_INTERNAL_OLIGO': 1, 'PRIMER_INTERNAL_MAX_SELF_END': 8, 'PRIMER_MIN_SIZE': 18, 'PRIMER_MAX_SIZE': 25, 'PRIMER_OPT_TM': 60.0, 'PRIMER_MIN_TM': 57.0, 'PRIMER_MAX_TM': 63.0, 'PRIMER_MIN_GC': 20.0, 'PRIMER_MAX_GC': 80.0, 'PRIMER_MAX_POLY_X': 100, 'PRIMER_INTERNAL_MAX_POLY_X': 100, 'PRIMER_SALT_MONOVALENT': 50.0, 'PRIMER_DNA_CONC': 50.0, 'PRIMER_MAX_NS_ACCEPTED': 0, 'PRIMER_MAX_SELF_ANY': 12, 'PRIMER_MAX_SELF_END': 8, 'PRIMER_PAIR_MAX_COMPL_ANY': 12, 'PRIMER_PAIR_MAX_COMPL_END': 8, 'PRIMER_PRODUCT_SIZE_RANGE': [ [75,100],[100,125],[125,150], [150,175],[175,200],[200,225] ], }) ``` ## Advanced Installation Users interested in contributing to development may want to work with the latest development build. To get the latest and greatest code, head over [our Github repo](https://github.com/libnano/primer3-py) and clone the repo or download a tarball. Building from source is easy. If you don't install the latest build via pip or conda, you might have to install `Cython`, prior to running the `setup.py` script: ``` $ pip install Cython ``` Or via `conda`: ``` $ conda install Cython ``` Then run: ``` $ python setup.py install ``` or if you are developing `primer3-py` enhancements: ``` $ python setup.py build_ext --inplace ``` We recommend running `setup.py` with either `build_ext --inplace` or `develop` rather than `install` if you are testing development builds. `build_ext --inplace` will build the Cython and C API extensions in the package directory without copying any files to your local environment site-packages directory (so you can import and run tests from within the package) and `develop` will build in place and then put symlinks in your site packages directory (this will allow Primer3-py) NOTE: If you're attempting to build on Windows, please review the `primer3` documentation regarding environment requirements. You'll need to install the latest version of the TDM-GCC MinGW Compiler if building in a `MinGW / Mingw-w64` environment: [TDM-GCC MinGW Compiler](https://jmeubank.github.io/tdm-gcc/) ## Testing Every commit pushed to [the primer3-py GitHub repo](https://github.com/libnano/primer3-py) is tested to ensure it builds properly and passes our unit testing framework as a GitHub action If you'd like to run the tests yourself, we suggest the following workflow: ``` $ git clone https://github.com/libnano/primer3-py $ cd primer3-py $ python setup.py build_ext --inplace $ pytest ``` NOTE: `pip` / `conda` install `pytest` if not in your environment ## Contributing Contributions are welcomed via pull requests. Contact the `primer3-py` maintainers prior to beginning your work to make sure it makes sense for the project. By contributing, you also agree to release your code under the GPLv2 After a successful PR will be listed under the [contributors](https://github.com/libnano/primer3-py/graphs/contributors). ### Forking A forking workflow is preferred for all pull requests. ### Branch naming Branch naming is preferred to use the format: ``` - ``` Keep branch names not too long. A good example would be for the user `grinner` for a documentation update for the 1.0.0 staging branch: ```bash $ git checkout -b grinner-docs-update-1.0.0-pass-01 ``` With the trailing 01 indicative of it being part of several potential Another example pass that focuses on code clarity comments would be: ```bash $ git checkout -b grinner-code-clarity-and-comments ``` ### Development Development requires the use of C Python 3.8+, [pytest](https://docs.pytest.org) and [pre-commit](https://pre-commit.com) as they are used to build and run primer3-py code CI in the GitHub Action. Install these dependencies in your python development environment (`virtualenv`, `conda`, etc): ```bash $ pip install cython pre-commit pytest # or $ conda install cython pre-commit pytest ``` Install `pre-commit` in repo the with: ```bash $ pre-commit install ``` To ensure the git hook is excecuted on every commit. ### Pull Requests Pull Requests should meet the following requirements: 1. Excellent PR description describing all changes made. Please use markdown syntax highlighting to help readability. 2. If change is code related, have test coverage for the changes implemented. 3. Attempt to make the PR 1 commit only. Multiple are OK if it helps illustrate the change better. 4. Commit messages should describe the changes. 5. Provided you contact the maintainers in advance, theu will code review your PR, provide feedback and squash merge your code on approval. **TIP**: Interactive `rebase` is helpful to fix old commit messages. For example, run: ```bash $ git rebase -i HEAD~2 ``` To rebase the last 2 commits. Use `s` to mark the most recent commit(s), save, then modify the collective commit messages to update poor commit messages.