Getting Started

Primer3-py is designed to be simple to install and use.

Requirements

Primer3-py is built and tested on Mac OS X and Linux systems; we do not provide official Windows support. Python versions 3.8 - 3.11 are supported.

Installation

If you want to install the latest stable build of Primer3-py, you can install it using pip:

$ pip install primer3-py

Or via conda:

$ conda install primer3-py

Thermodynamic analysis

The thermodynamic bindings include support for Tm, homodimer, heterodimer, hairpin, and 3’ end stability calculations:

calc_tm(seq, mv_conc=50, dv_conc=0, dntp_conc=0.8, dna_conc=50, dmso_conc=0.0, dmso_fact=0.6, formamide_conc=0.8, annealing_temp_c=-10.0, max_nn_length=60, tm_method='santalucia', salt_corrections_method='santalucia')

Calculates the melting temperature of a DNA sequence, seq. Returns the melting temperature (C) as a float:

>>> primer3.calc_tm('GTAAAACGACGGCCAGT')
49.16808228911765

Note that NN thermodynamics will be used to calculate the Tm of sequences up to 60 bp in length, after which point the following formula will be used:

Tm = 81.5 + 16.6(log10([mv_conc])) + 0.41(%GC) - 600/length
calc_hairpin(seq, mv_conc=50.0, dv_conc=0.0, dntp_conc=0.8, dna_conc=50.0, temp_c=37, max_loop=30, output_structure=False)

Calculates the hairpin formation thermodynamics of a DNA sequence, seq. Returns a ThermoResult object that provides access to the thermodynamic characteristics of the result:

>>> res = primer3.calc_hairpin('CCCCCATCCGATCAGGGGG')
>>> print(res)
ThermoResult(structure_found=True, tm=34.15, dg=337.09, dh=-36300.00,
             ds=-118.13, msg=)
>>> print(res.tm)
34.14640571476207
>>> print('%f, %f, %f' % (res.dg, res.dh, res.ds))
337.086509, -36300.000000, -118.126992

Note that at least one of the two sequences must by <60 bp in length. This is a cap imposed by Primer3 as the longest reasonable sequence length for which a two-state NN model produces reliable results (see primer3/src/libnano/thal.h:59).

calc_homodimer(seq, mv_conc=50.0, dv_conc=0.0, dntp_conc=0.8, dna_conc=50.0, temp_c=37, max_loop=30, output_structure=False)

Calculates the homodimer formation thermodynamics of a DNA sequence, seq. Returns a ThermoResult object that provides access to the thermodynamic characteristics of the result (see calc_hairpin() doc for more information).

Note that the maximum length of ``seq`` is 60 bp. This is a cap imposed by Primer3 as the longest reasonable sequence length for which a two-state NN model produces reliable results (see primer3/src/libprimer3/thal.h:59).

calc_heterodimer(seq1, seq2, mv_conc=50.0, dv_conc=0.0, dntp_conc=0.8, dna_conc=50.0, temp_c=37, max_loop=30, output_structure=False)

Calculates the heterodimerization thermodynamics of two DNA sequences, seq1 and seq2. Returns a ThermoResult object that provides access to the thermodynamic characteristics of the result (see calc_hairpin() doc for more information).

Note that at least one of the two sequences must by <60 bp in length. This is a cap imposed by Primer3 as the longest reasonable sequence length for which a two-state NN model produces reliable results (see primer3/src/libprimer3/thal.h:59).

calc_end_stability(seq1, seq2, mv_conc=50.0, dv_conc=0.0, dntp_conc=0.8, dna_conc=50.0, temp_c=37, max_loop=30)

Calculates the 3’ end stability of DNA sequence seq1 against DNA sequence seq2. Returns a ThermoResult object that provides access to the thermodynamic characteristics of the result (see calc_hairpin() doc for more information).

Note that at least one of the two sequences must by <60 bp in length. This is a cap imposed by Primer3 as the longest reasonable sequence length for which a two-state NN model produces reliable results (see primer3/src/libprimer3/thal.h:59).

All of these low-level thermodynamic functions share a set of keyword arguments used to define the parameters of the respective calculation:

For all low-level calculations:
mv_conc (float/int)

Monovalent cation concentration (mM)

dv_conc (float/int)

Divalent cation concentration (mM)

dntp_conc (float/int)

dNTP concentration (mM)

dna_conc (float/int)

DNA concentration (nM)

For homodimer/heterodimer/end stabilty calculation:
temp_c (int)

Simulation temperature for dG calcs (C)

max_loop (int)

Maximum size of loops in the structure

For Tm calculations:
dmso_conc (float)

Concentration of DMSO (%)

dmso_fact (float)

DMSO correction factor

formamide_conc (float)

Concentration of formamide (mol/l)

annealing_temp_c (float)

Actual annealing temperature of the PCR reaction

max_nn_length (int)

Maximum length for nearest-neighbor calcs

tm_method (str)

Tm calculation method (breslauer or santalucia)

salt_corrections_method

Salt correction method (schildkraut, wczarzy, santalucia)

Primer design

Primer3-py includes bindings for the Primer3 primer design pipeline. The parameters for the design process are provided as Python dictionaries that mirror the BoulderIO input files required by the Primer3 binaries. There are numerous examples of how to use the pipeline in the tests/ directory.

For documentation regarding the input and output parameters of the pipeline, please see the Primer3 2.6.1 documentation (the underlying library for this package is a derivative of v2.6.1).

It is worth noting that some of the inputs deviate from the string format described in the Primer3 documentation, with notable exceptions being related to index lists and ranges (i.e., ranges are typically provided as lists/tuples, and lists of ranges as lists of lists or tuples of tuples). Here we highlight the differences between the typical SEQUENCE_PRIMER_PAIR_OK_REGION_LIST input and the Python binding input:

Primer3 BoulderIO input:      100,50,300,50 ; 900,60,,
Primer3-py Python input:      [[100,50,300,50], [900,60,-1,-1]]

Similarly, PRIMER_PRODUCT_SIZE_RANGE is provided in the following forms:

Primer3 BoulderIO input:      75-100 100-125 125-150
Primer3-py Python input:      [[75,100],[100,125],[125,150]]

Workflow

The easiest way to run the primer design pipeline is with design_primers(). Notice that Primer3 parameters prefixed with “SEQUENCE_” are provided in a separate dictionary from those prefixed with “PRIMER_”. For more advanced / modular approaches, see the Primary analysis and design API documentation.

primer3.bindings.design_primers(seq_args, global_args, misprime_lib=None, mishyb_lib=None)[source]

Run the Primer3 design process.

Parameters:

  • seq_args (Dict[str, Any]) – Primer3 sequence/design args as per Primer3 docs

  • global_args (Dict[str, Any]) – Primer3 global args as per Primer3 docs

  • misprime_lib (Optional[Dict[str, Any]]) – Sequence name: sequence dictionary for mispriming checks.

  • mishyb_lib (Optional[Dict[str, Any]]) – Sequence name: sequence dictionary for mishybridization checks.

Return type:

Dict[str, Any]

Returns:

A dictionary of Primer3 results (should be identical to the expected BoulderIO output from primer3_main)

Example usage:

bindings.design_primers(
    seq_args={
        'SEQUENCE_ID': 'MH1000',
        'SEQUENCE_TEMPLATE': 'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTACATTTT'
                             'AGCATCAGTGAGTACAGCATGCTTACTGGAAGAGAGGGTCATGCA'
                             'ACAGATTAGGAGGTAAGTTTGCAAAGGCAGGCTAAGGAGGAGACG'
                             'CACTGAATGCCATGGTAAGAACTCTGGACATAAAAATATTGGAAG'
                             'TTGTTGAGCAAGTNAAAAAAATGTTTGGAAGTGTTACTTTAGCAA'
                             'TGGCAAGAATGATAGTATGGAATAGATTGGCAGAATGAAGGCAAA'
                             'ATGATTAGACATATTGCATTAAGGTAAAAAATGATAACTGAAGAA'
                             'TTATGTGCCACACTTATTAATAAGAAAGAATATGTGAACCTTGCA'
                             'GATGTTTCCCTCTAGTAG',
        'SEQUENCE_INCLUDED_REGION': [36,342]
    },
    global_args={
        'PRIMER_OPT_SIZE': 20,
        'PRIMER_PICK_INTERNAL_OLIGO': 1,
        'PRIMER_INTERNAL_MAX_SELF_END': 8,
        'PRIMER_MIN_SIZE': 18,
        'PRIMER_MAX_SIZE': 25,
        'PRIMER_OPT_TM': 60.0,
        'PRIMER_MIN_TM': 57.0,
        'PRIMER_MAX_TM': 63.0,
        'PRIMER_MIN_GC': 20.0,
        'PRIMER_MAX_GC': 80.0,
        'PRIMER_MAX_POLY_X': 100,
        'PRIMER_INTERNAL_MAX_POLY_X': 100,
        'PRIMER_SALT_MONOVALENT': 50.0,
        'PRIMER_DNA_CONC': 50.0,
        'PRIMER_MAX_NS_ACCEPTED': 0,
        'PRIMER_MAX_SELF_ANY': 12,
        'PRIMER_MAX_SELF_END': 8,
        'PRIMER_PAIR_MAX_COMPL_ANY': 12,
        'PRIMER_PAIR_MAX_COMPL_END': 8,
        'PRIMER_PRODUCT_SIZE_RANGE': [
            [75,100],[100,125],[125,150],
            [150,175],[175,200],[200,225]
        ],
    })

Advanced Installation

Users interested in contributing to development may want to work with the latest development build. To get the latest and greatest code, head over our Github repo and clone the repo or download a tarball. Building from source is easy.

If you don’t install the latest build via pip or conda, you might have to install Cython, prior to running the setup.py script:

$ pip install Cython

Or via conda:

$ conda install Cython

Then run:

$ python setup.py install

or if you are developing primer3-py enhancements:

$ python setup.py build_ext --inplace

We recommend running setup.py with either build_ext --inplace or develop rather than install if you are testing development builds. build_ext --inplace will build the Cython and C API extensions in the package directory without copying any files to your local environment site-packages directory (so you can import and run tests from within the package) and develop will build in place and then put symlinks in your site packages directory (this will allow Primer3-py)

NOTE: If you’re attempting to build on Windows, please review the primer3 documentation regarding environment requirements. You’ll need to install the latest version of the TDM-GCC MinGW Compiler if building in a MinGW / Mingw-w64 environment: TDM-GCC MinGW Compiler

Testing

Every commit pushed to the primer3-py GitHub repo is tested to ensure it builds properly and passes our unit testing framework as a GitHub action

If you’d like to run the tests yourself, we suggest the following workflow:

$ git clone https://github.com/libnano/primer3-py
$ cd primer3-py
$ python setup.py build_ext --inplace
$ pytest

NOTE: pip / conda install pytest if not in your environment

Contributing

Contributions are welcomed via pull requests.

Contact the primer3-py maintainers prior to beginning your work to make sure it makes sense for the project.

By contributing, you also agree to release your code under the GPLv2

After a successful PR will be listed under the contributors.

Forking

A forking workflow is preferred for all pull requests.

Branch naming

Branch naming is preferred to use the format:

<GitHub user-name>-<short keyword description of change>

Keep branch names not too long. A good example would be for the user grinner for a documentation update for the 1.0.0 staging branch:

$ git checkout -b grinner-docs-update-1.0.0-pass-01

With the trailing 01 indicative of it being part of several potential

Another example pass that focuses on code clarity comments would be:

$ git checkout -b grinner-code-clarity-and-comments

Development

Development requires the use of C Python 3.8+, pytest and pre-commit as they are used to build and run primer3-py code CI in the GitHub Action.

Install these dependencies in your python development environment (virtualenv, conda, etc):

$ pip install cython pre-commit pytest
# or
$ conda install cython pre-commit pytest

Install pre-commit in repo the with:

$ pre-commit install

To ensure the git hook is excecuted on every commit.

Pull Requests

Pull Requests should meet the following requirements:

  1. Excellent PR description describing all changes made. Please use markdown syntax highlighting to help readability.

  2. If change is code related, have test coverage for the changes implemented.

  3. Attempt to make the PR 1 commit only. Multiple are OK if it helps illustrate the change better.

  4. Commit messages should describe the changes.

  5. Provided you contact the maintainers in advance, theu will code review your PR, provide feedback and squash merge your code on approval.

TIP: Interactive rebase is helpful to fix old commit messages. For example, run:

$ git rebase -i HEAD~2

To rebase the last 2 commits. Use s to mark the most recent commit(s), save, then modify the collective commit messages to update poor commit messages.